Need Help ?

Expert Answers

There's a video to watch to answer the following questions website: http://www.m ...

There's a video to watch to answer the following questions website: http://www.monkey see.com Understanding Glycemic Index and Glycemic Load/n1. What is the difference between glycemic load and glycemic index? (Hint: look at how many carbs's worth of food is used to calculate glycemic load vs. glycemic index)

READ MORE >>

5:54 < Chapter 15 Workbook pd... Q 344 Section 3 Surgical Procedures Identificat ...

5:54 < Chapter 15 Workbook pd... Q 344 Section 3 Surgical Procedures Identification: Instrumentation 1. Identify the vaginal retractors shown in Figure 15-1. A B. C. D. ? Figure 15-1 C Dashboard 000 000 Figures 15-1140 Dourtesy of ire © 2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part Calendar 1 5G To Do B Notifications Inbox < Chapter 15 Workbook pd... Q 5:54 2. Identify the cervical and uterine instruments shown in Figure 15-2. E Figure 15-2 A. B. C. D. E. F. !! 00 00 100 Dashboard 52 F 000 000 Figures 15-2AHF). Courtesy of Integra Miltex, a business of integra LifeSciences Corporation, Plainsboro, NJ, USA Calendar 2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part. 1 5G To Do B Chapter 15 Obstetric and Gynecologic Surgery 345 Notifications Inbox 346 Section 3 Surgical Procedures 5:54 3. Identify the retracting instruments shown in Figure 15-3. A. B. C. Chapter 15 Workbook pd... Q Figure 15-3 D. E. F. G. Dashboard 000 000 Calendar ©2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part 1 2 To Do 5G D Figures 15-3A-G) Courtesy of Integra Mitex, a business of integra LifeSci Notifications Inbox < Chapter 15 Workbook pd... Q 4. Identify the instruments shown in Figure 15-4. Figure 15-4 A. B. C. D. E. 5:54 F. G. H. I •ANITHY J. K. ?? 348 Section 3 Surgical Procedures Dashboard il 000 000 Calendar 1 5G Chapter 15 Obstetric and Gynecologic Surgery do To Do B © 2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part. 347 Notifications Figures 15-4AHKI C Inbox 5:53 Chapter 15 Workbook pd... Q 342 Section 3 Surgical Procedures 3. What does an elevated serum CA-125 test indicate? 2. What ligaments provide support for the ovaries? During an oophorectomy, which is ligated first? 4. Fill in the blank: Myomectomy is the excision of 5. What should be done as warm, moist lap sponges are used to pack the bowel cephalad? 6. What structure(s) is (are) removed during a TAH? 7. Anticipation for a TAH dissection requires some modification. Describe what you will pass. 8. Identify which procedure ligates the following ligaments first. A. Uterosacral ligaments B. Round and ovarian ligaments 9. Why are the Jorgenson scissors and surrounding clamps considered contaminated? 10. What are the advantages of the LAVH approach? 11. What positioning tool is used to facilitate a low lithotomy position? 12. Where is the robotic cart with arms positioned for a robot-assisted hysterectomy? 13. Describe the structures removed for a Wertheim procedure. What is the alternate name for the procedure? Dashboard ©2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part. 000 000 5G Calendar D 1 To Do Notifications 343 Inbox

READ MORE >>

2. Given the below DNA sequence and the given Forward primer sequence (highlight ...

2. Given the below DNA sequence and the given Forward primer sequence (highlighted in yellow), design the reverse primer sequence (of a 20bp length) that you would have to purchase if you want to generate a 876bp amplicon. GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTG CTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCC AGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTG ATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGG GGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCA CACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTG CCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGG GGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGAC TGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGA CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGT GTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGA CAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGG TCCTGGGGATAGGGG

READ MORE >>

Problem 4 (20 points). There are a wide number of student groups on campus, and ...

Problem 4 (20 points). There are a wide number of student groups on campus, and many that are specific to the CEAE department. Identify a student group that you are interested in joining. (a) write a ½ page description of the organization, or group of which the local chapter represents. (b) then attend one of their meetings in the next two weeks, and write a brief summary (2-3 sentences) of what occurred during the meeting (feel free to include a screenshot of the meeting to document your attendance). Student groups include: AEI, AGC, ASHRAE, ASCE, EIA, EERI, EWB, and IES (the full list). If you are unable to attend a meeting before the due date of this assignment, then include one sentence about when the next meeting will take place, and when you will attend.

READ MORE >>

Q2: How does visionary outlook skill relate to the board of directors? ...

Q2: How does visionary outlook skill relate to the board of directors?

READ MORE >>

Essay topic choices: You have a choice of two (2) essay topics, from which you c ...

Essay topic choices: You have a choice of two (2) essay topics, from which you choose one (1) to respond to. The two options are outlined below:

READ MORE >>

Instructions for Final Animal Behavior Project Design an Ethogram-Based Research ...

Instructions for Final Animal Behavior Project Design an Ethogram-Based Research Project Using the Scientific Method Objectives: ? ? To understand the process of the Scientific Method. Apply the knowledge of ethograms and animal behavior to design a research project. Develop skills in formulating research questions, designing experiments, and proposing data collection methods using ethograms. To design an observational study on animal behavior using live animal cameras, incorporating an experimental variable, a control variable, and a dependent variable. Task: Design an experiment using the animal you chose for this project (from Lab 3). A. Watch the Lab 8 Power Point Presentation B. Upload a document to the Experimental Design Dropbox with your responses to the following 14 prompts: 1. Select the Study Species: Choose a species that is relevant to your research question and accessible for observation. Give the common name of the animal Give the scientific name of the animal • Genus • species 2. Determine the Observation Setting: a. Identify the appropriate setting for conducting your observations. This could be in the animal's natural habitat, a controlled laboratory environment, or a specific enclosure. b. List the website of the live cameras you would use to conduct the experiment. 3. Select Observation Methods: Determine the most suitable observation methods to collect data on animal behavior. This can include video recordings or the use of live animal cameras. 4. Define the Research Question: Clearly state the research question that you aim to address through your observations. 5. Formulate a hypothesis: Use creative thinking to combine isolated facts into a cohesive whole. It is more than a guess; it is based on existing knowledge. It must be something that can be tested (is falsifiable). The Hypothesis needs to be possible explanation for an observation. Describe what the expected behavior will be and why this behavior is happening. Use the information from your peer-reviewed literature search. 6. Define the Experimental Variable 7. Define the Control Variable. 8. Define additional control variables that will be kept constant across both groups. 9. Define the Dependent Variables: Select dependent variables that will be measured and compared between the experimental and control groups. 10. Develop an Ethogram: Create an ethogram table that lists and defines the behaviors, including the codes for these behaviors. 11. Data Collection: the duration of the observation period number of animals in each group (experimental and control. the frequency of observations any other relevant factors to ensure accurate data collection. 12. Data Analysis: Plan the data analysis methods that align with your research question and the type of data collected. This may include quantitative analysis techniques such as calculating frequencies, durations, or correlations, as well as qualitative analysis for behavioral descriptions. 13. Discussion and Conclusion: a) Reflect on the potential outcomes and their implications for the research question. b) Discuss the limitations of the study and suggest potential areas for further research. 14. Summarize your research study. • Incorporate the information you found in the peer-reviewed literature. • Minimum of 300 words. Examples of Experimental Variables that you can use to design the experiment: 1. Time of Day: The time of day can influence the activity patterns of animals. Different species may exhibit distinct behaviors during morning, afternoon, and evening. 2. Weather Conditions: Environmental factors such as temperature, humidity, and precipitation can affect animal behavior. For instance, animals may seek shelter during rain or become more active on cooler days. 3. Social Interactions: The presence and interactions of conspecifics (members of the same species) can impact animal behavior. Observing social dynamics can reveal dominance hierarchies, affiliative behaviors, and other social interactions. 4. Availability of Food: The presence and abundance of food sources in the animal's habitat can influence their foraging behavior and feeding patterns. Food availability may vary naturally, affecting the animals' activities. 5. Presence of Threats: The presence of potential environmental threats can trigger defensive behaviors and influence the animals' vigilance and movement. 6. Presence of Visitors or External Stimuli: If the animal habitat is accessible to visitors or there are external stimuli (e.g., noise, movement) from the surroundings, animals may react differently in response to human presence or disturbances. 7. Life Stage: Animals may exhibit different behaviors at various life stages, such as during infancy, adolescence, or adulthood. Observing these differences can shed light on how behaviors change as individuals age. 8. Interactions with Other Species: Observing interactions between different species, such as symbiotic relationships, competition for resources, or cooperative behaviors, can highlight the complexities of ecological interactions and species coexistence. 9. Predator-Prey Interactions: The presence of predators and their hunting behaviors, as well as the responses of potential prey species, can reveal intricate predator-prey interactions and survival strategies./n. INSTRUCTIONS ANIMAL USED IN LAB IS RED PANDA Word Limit 500 words For Whole project APA Format

READ MORE >>

Lab 8 Using your textbook as a reference, answer the following questions: 1. Wha ...

Lab 8 Using your textbook as a reference, answer the following questions: 1. What is a species? A species is often defined as group of organisms thautive capable of interbreeding, producing offspring in natural conditions Coumpbell) (8th Canadian ed. of

READ MORE >>

1. Review the rubric to make sure you understand the criteria for earning your g ...

1. Review the rubric to make sure you understand the criteria for earning your grade. 2. In your textbook, Physical Examination & Health Assessment , review Chapters 3, 4, and 5. 3. Download and review the file Erikson Developmental Stages. 4. Access an additional resource available to you to help with creating care plans, an ebook from the OCLS collection, Nursing Diagnosis Handbook. There are several editions of this book available, besides the one that is linked. Simply search the title. 5. Prepare to discuss the following prompts: a. Using examples of clients from your experience, and with HIPAA regulations in mind, consider two clients with the same medical diagnosis i.e. asthma, flu, seizure disorder…who were at different levels of physical development and at different stages of Erikson’s developmental stages. b. Provide an example of two nursing diagnoses (one for each of the two developmental stages), two goals (one for each nursing diagnosis), and two interventions for each diagnosis and describe how the plan of care would be implemented differently based on each developmental stage described above. Be descriptive and detailed in your response. 6. Research and select at least two current scholarly sources to support your explanations and insights. OCLS resources are preferred sources and can be accessed through IWU Resources. Wikipedia is not permitted, as it is not a peer-reviewed, scholarly source.

READ MORE >>

Question 3: Re-read: Munroe & Lambert (2022). If I could change one thing in edu ...

Question 3: Re-read: Munroe & Lambert (2022). If I could change one thing in education: Community- school partnerships would be top priority What is your understanding of how Munroe & Lambert talk about environments? How can you relate their work to ideas about implicit bias and barriers to equity discussed in class and in the course text: Don't Look Away? Provide two examples.

READ MORE >>
QUICK ORDER

Place a Quick Order

Our verified writers got you covered. Let us help you balance between studies, work, and family.

We provide our assistance to the numerous clients looking for a professional writing service.

Order Now
Designed and developed by Brian Mubichi (mubix)
WhatsApp