Expert Answers

Creating & Presenting = 15 Date: Reflecting, Responding & Analyzing=_____/10 Name: Instructions: Media Arts Journal: Digital Imaging Course Expectations Creating and Presenting - A1.3 Produce and refine media art works, using experimentation, peer and/or teacher input, and personal reflection. A1.4 Present media art works, individually and/or collaboratively, using a variety of methods that are appropriate for their work. A1.5 Use a variety of tracking tools to document their use of the creative process, and use thai record as a basis for reflection on the effectiveness of their procedures. A3.1 Explore a variety of traditional and emerging technologies, tools, and techniques, and use them to produce effective media art works. Reflecting, Responding & Analyzing - B1.1 Identify and describe their initial responses to media art works, using various strategies and modes of communication. B1.3 Use the critical analysis process to assess the effectiveness of media art works in communicating a message or expressing an emotion, and describe how their assessment of the works has evolved throughout the critical analysis process. B1.4 Communicate an understanding of how they use the stages of the critical analysis process when they are creating their own media art works. ASM201 Foundations Foundations - C1.1 Identify the stages of the creative and critical analysis processes, and identify and correctly use terminology related to the conventions and concepts of media arts when creating and analysing media art works. C1.2 Identify and describe some elements from contributing arts that are used in media arts, and describe some of the principles of media arts that can be applied to organize these elements. C1.3 Correctly use terminology related to the technologies, tools, and techniques used in the production and presentation of media art works. Did you... 1. Create a minimum of three different digital images, each digital image should be focusing on a different art element: line, shape, colour, form, space, texture and/or value. Rationale: Throughout this unit we have been learning about the seven different elements of art: line, shape, colour, form, space, texture and value. Moreover, we have been analyzing and identifying each art element's effect on digital images, and applying each art element on various digital images. In this assignment, you will be able to evaluate and submit samples of digital images that you have applied one or more art elements to and reflect on your learning process thus far. 2. Write a one to two page reflection, double spaced, for EACH digital image (i.e. this means you will be writing a total of three reflections). Each reflection should aim to answer the following prompts using full sentences and paragraphs: a. How is the art element shown in your digital image? b. What are a minimum of two techniques that you used while adding the art element in your digital image? c. Which technique did you find the most useful/helpful and why? d. Which art element do you think is the most important when creating a digital image of the subject in your artwork and why? e. What is one thing that you could change or add if you could redo your digital image? = 15 YES NO Due Date Ms. P.Chau 3. Submit the following under the "Assignment” tab entitled “Media Arts Journal - Digital Imaging": a. Three different digital images created by you, each focusing on a different art element; & b. Three different 1-2 page reflections/journal entries. 4. Choose one out of your three journal entries and share it under discussions. Read one or more of your peers' shared journal entries and respond to one. Your response should be between 50-100 words in length and should be specific. a. Comment: I agree/l disagree/l think... (Point out something significant or important in the post) b. Support: Because ... (Give a reason for your comment. Back it up) c. Question: Why did this...? How did this...? What if...? (Ask open-ended questions that will extend discussion) Rubric: Achievement/ Categories Demonstrates understanding of the media arts terminology Critically reflects on use of media arts techniques and the different art elements Uses media arts techniques appropriately and effectively Expresses content clearly and communicates with classmates for the purpose of adding to and/or extending the discussion Comments: ASM201 d. Be Polite: It is important to be a good digital citizen and conduct yourself online in a polite and respectful way, make sure you are sensitive with your word choice Below Level 1 (0-49%) Student demonstrates no understanding of the media arts terminology Student does not critically reflect on use of media arts techniques and the different art elements Student does not use any of the media arts techniques appropriately or effectively Student is unable to express content and does not communicate with classmates Level 1 (50-59%) 1L 1M 1H 50-52 53-56 57-59 Student demonstrates limited understanding of the media arts terminology Student reflects vaguely on the use of 1-2 media arts techniques and the different art elements Student uses 1-2 of the media arts techniques appropriately but not effectively Student expresses content vaguely and communicates with classmates in a way that does not fit the purpose and does not extend discussion Level 2 (60-69%) 2L 2M 2H 60-62 63-66 67-69 Student demonstrates some understanding of the media arts terminology Student reflects to some degree on the use of 3-4 media arts techniques and different art elements Student uses 3-4 of the media arts techniques appropriately and somewhat effectively Student expresses content clearly but not concisely and communicates with classmates in a way that fits the purpose but does not extend discussion Level 3 (70-79%) 3L 70-72 73-76 3M 3H 4L 4M 77-79 80-86 86-95 Student demonstrates considerable understanding of the media arts terminology Student reflects considerably on the use of 5-6 media arts techniques and different art elements Student uses 5-6 of the media arts techniques appropriately and effectively Level 4 (80-100%) Student expresses content clearly and concisely and communicates with classmates in a way that fits the purpose and extends discussion 4H 95-100 Student demonstrates thorough understanding of the media arts terminology Student reflects thoroughly on the use of 6 or more media art techniques and different art elements Student uses 6 or more of the media arts techniques appropriately and very effectively Student expresses content very effectively and communicates with classmates highly effectively Strands Knowledge, Thinking, Application, Communication Foundations K= Reflecting, Responding & Analyzing T= 15 Creating & Presenting A = 15 Reflecting, Responding & Analyzing C = _/5 Ms. P.Chau

Need to Use photoshop to add color check the instructions for securing 5 points Program Used: Adobe Photoshop Tools Used: Procreate Primary: Paint Brush & Color Mixer Supplementary: Eye Dropper, Selection Tools, Rulers & Layers/n

???? ??????? College of Engineering ?????? ????? QATAR UNIVERSITY 1. Objective: ? ? ? 2. Background: MECH 416 - Aircraft Design Assignment No (01): Aircraft Performance Analysis 3. Task: Understanding fundamental performance parameters Applying equations to calculate performance characteristics Interpreting and analysing performance results. Aircraft performance analysis is a critical component of aircraft design. It involves the evaluation of various factors such as aerodynamics, propulsion, and structures to determine how well an aircraft will perform under different conditions. The goal of performance analysis is to ensure that the aircraft meets its intended design requirements and is safe, efficient, and cost-effective to operate. It also allows for the optimization of the aircraft's performance, which can lead to improved fuel efficiency, increased range, and reduced maintenance costs. Overall, performance analysis is an essential part of aircraft design, as it ensures that the aircraft meets the needs of its intended users and performs reliably and efficiently. ? The data for the small single-seat home-built jet airplane are as follows: Wing span: 5.2 m. Wing planform area: 3.5 m². Gross weight at take-off: 4270 N. Fuel capacity: 55gal. (1 gallon of JP-4 ? 3.08 kg) Power plant: one French-built Microturbo TRS 18 turbojet engine with maximum thrust at sea level of 898.5 N and a specific fuel consumption of 1.3 N/(N.hr) the drag polar for this airplane can be estimated to be: ? In this assignment, you will make a Performance analysis for small single-seat home-built jet airplane, using the following information and requirements: ? ????? ??? QATAR UNIVERSITY Cp = 0.02 +0.062C² Page 1 of 3 ???? ??????? College of Engineering ????? ??? QATAR UNIVERSITY a. the maximum velocity at sea level and b. the maximum velocity at 3.048 km. 1. Plot the thrust required and thrust available curves at sea level, and from these curves obtain the maximum velocity at sea level. 2. Plot the thrust required and thrust available curves at 3.048 km, and from these curves obtain the maximum velocity at 3.048 km. 3. calculate analytical (directly) Vmax 1/2 ?(TA) [(TA)max/w] (W/s) + (W/s) ? [(T?)max/w] -4CD,K Poo CDo Max Thrust available at altitude can be estimated by using this Equation (T^) max = (T?). [206 ? Compare the result in 3 with those from 1 & 2. 4. calculate 2 6. Use the analytical results to calculate directly ????? ??? a. The maximum value of CL/ CD b. The maximum value of C?¹/2/CD c. The maximum value of C?³/2/CD d. The velocities at which they occur at sea level e. The velocities at which they occur at 10,000 ft 5. Plot the power required and power available curves at sea level. From these curves, estimate the maximum rate of climb at sea level. a. Maximum rate of climb at sea level and the velocity at which it occurs. Compare with your graphical result from 5. b. Maximum climb angle at sea level and the velocity at which it occurs. 7. Consider our Aircraft flying at 10,000 ft. Assume a sudden and total loss of engine thrust. Calculate QATAR UNIVERSITY a. the minimum glide path angle, b. the maximum range covered over the ground during the glide, and C. the corresponding equilibrium glide velocities at 10,000 ft and at sea level. Page 2 of 3 ???? ??????? College of Engineering ????? ??? QATAR UNIVERSITY 10. Using the analytical approach described in Lecture Note 6 page 12, calculate the minimum time to climb to 10,000 ft. 8. Plot the maximum rate of climb versus altitude. From this graph, estimate the service ceiling. 9. analytically calculate the service ceiling, and compare this result with the graphical solution obtained in 8. 11. Estimate the maximum range at an altitude of 10,000 ft. Also, calculate the flight velocity required to obtain this range. 12. Estimate the maximum endurance. 4. Requirements: ? 5. Grading Rubric: ????? ??? ? QATAR UNIVERSITY ? Choose either MATLAB or an Excel spreadsheet for your analysis. Use scientific principles and relevant equations to perform the calculations. Document your code with clear comments explaining each step and the formulas used. ? Accuracy: Correctness of calculations. Analysis: Ability to interpret results and draw meaningful implications (e.g., how do the results compare to typical aircraft of that class, or inform aircraft design choices). Clarity: Presentation of calculations and explanations. Page 3 of 3

Question 1 Without a clear vision, it becomes challenging for a leader to craft strategies to attain personal or organisational goals. Reflect on the vision that you have formed for yourself as a leader, and then write a cohesive response to the question below. What is your vision as a leader? Start writing here: (Max. 150 words) Question 2 However, simply identifying a vision is not enough. Your vision should be communicated in a compelling way to your followers in order to gain their commitment to it. Reflect on how you currently communicate your vision to your followers, and then write a cohesive response to the question below. How do you communicate your vision to your followers? (Max. 200 words)

1. In a completely randomized design, there are two factors, A with two levels and B with three levels. Suppose the 6 treatment means are 116, 12 = 10,13 = 8 H21 = 5, 22 = 5,/23 = 5. Note these are the true treatment means and are supposed to be known. Answer the following questions. a. [3pts] Are there interaction effects? Why? [Hint: Use the definition of interations.] b. [3pts] Find ?, ai, Bj and (aß)ij, i = 1, 2, j = 1, 2, 3, such that Hij = ?l + ai + Bj + (aß)ij.

Westside Energy charges its electric customers a base rate of $6.00 per month, plus 15€ per kilowatt-hour (kWh) for the first 300 kWh used and 2€ per kWh for all usage over 300 kWh. Suppose a customer uses x kWh of electricity in one month. (a) Express the monthly cost E as a piecewise defined function of x. (Assume E is measured in dollars.) E(x) = Need Help? (b) Graph the function E for 0 sxs 600. E 60 50 L 40 30 20 10 E 60p 50 40 30 20 10 if 0 sxs 300 Read It if 300 < x 100 200 X 300 400 500 600 100 200 300 400 500 600 Watch It E 100 80 60 40 20 X 100 200 300 400 500 600 E 60 50 40 V 30 20 10 3 100 200 300 400 500 600

There's a video to watch to answer the following questions website: http://www.monkey see.com Understanding Glycemic Index and Glycemic Load/n1. What is the difference between glycemic load and glycemic index? (Hint: look at how many carbs's worth of food is used to calculate glycemic load vs. glycemic index)

5:54 < Chapter 15 Workbook pd... Q 344 Section 3 Surgical Procedures Identification: Instrumentation 1. Identify the vaginal retractors shown in Figure 15-1. A B. C. D. ? Figure 15-1 C Dashboard 000 000 Figures 15-1140 Dourtesy of ire © 2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part Calendar 1 5G To Do B Notifications Inbox < Chapter 15 Workbook pd... Q 5:54 2. Identify the cervical and uterine instruments shown in Figure 15-2. E Figure 15-2 A. B. C. D. E. F. !! 00 00 100 Dashboard 52 F 000 000 Figures 15-2AHF). Courtesy of Integra Miltex, a business of integra LifeSciences Corporation, Plainsboro, NJ, USA Calendar 2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part. 1 5G To Do B Chapter 15 Obstetric and Gynecologic Surgery 345 Notifications Inbox 346 Section 3 Surgical Procedures 5:54 3. Identify the retracting instruments shown in Figure 15-3. A. B. C. Chapter 15 Workbook pd... Q Figure 15-3 D. E. F. G. Dashboard 000 000 Calendar ©2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part 1 2 To Do 5G D Figures 15-3A-G) Courtesy of Integra Mitex, a business of integra LifeSci Notifications Inbox < Chapter 15 Workbook pd... Q 4. Identify the instruments shown in Figure 15-4. Figure 15-4 A. B. C. D. E. 5:54 F. G. H. I •ANITHY J. K. ?? 348 Section 3 Surgical Procedures Dashboard il 000 000 Calendar 1 5G Chapter 15 Obstetric and Gynecologic Surgery do To Do B © 2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part. 347 Notifications Figures 15-4AHKI C Inbox 5:53 Chapter 15 Workbook pd... Q 342 Section 3 Surgical Procedures 3. What does an elevated serum CA-125 test indicate? 2. What ligaments provide support for the ovaries? During an oophorectomy, which is ligated first? 4. Fill in the blank: Myomectomy is the excision of 5. What should be done as warm, moist lap sponges are used to pack the bowel cephalad? 6. What structure(s) is (are) removed during a TAH? 7. Anticipation for a TAH dissection requires some modification. Describe what you will pass. 8. Identify which procedure ligates the following ligaments first. A. Uterosacral ligaments B. Round and ovarian ligaments 9. Why are the Jorgenson scissors and surrounding clamps considered contaminated? 10. What are the advantages of the LAVH approach? 11. What positioning tool is used to facilitate a low lithotomy position? 12. Where is the robotic cart with arms positioned for a robot-assisted hysterectomy? 13. Describe the structures removed for a Wertheim procedure. What is the alternate name for the procedure? Dashboard ©2018 Cengage Learning. All Rights Reserved. May not be scanned, copied or duplicated, or posted to a publicly accessible website, in whole or in part. 000 000 5G Calendar D 1 To Do Notifications 343 Inbox

2. Given the below DNA sequence and the given Forward primer sequence (highlighted in yellow), design the reverse primer sequence (of a 20bp length) that you would have to purchase if you want to generate a 876bp amplicon. GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTG CTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCC AGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTG ATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGG GGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCA CACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTG CCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGG GGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGAC TGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGA CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGT GTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGA CAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGG TCCTGGGGATAGGGG

Problem 4 (20 points). There are a wide number of student groups on campus, and many that are specific to the CEAE department. Identify a student group that you are interested in joining. (a) write a ½ page description of the organization, or group of which the local chapter represents. (b) then attend one of their meetings in the next two weeks, and write a brief summary (2-3 sentences) of what occurred during the meeting (feel free to include a screenshot of the meeting to document your attendance). Student groups include: AEI, AGC, ASHRAE, ASCE, EIA, EERI, EWB, and IES (the full list). If you are unable to attend a meeting before the due date of this assignment, then include one sentence about when the next meeting will take place, and when you will attend.