Need Help ?

Expert Answers

Q1: Assignment: 1 Health Promotion Activities for people with Disabilities in KS ...

Q1: Assignment: 1 Health Promotion Activities for people with Disabilities in KSASee Answer

READ MORE >>

Q1: BIOL1181 2250 Assignment 1: Applied Theory (WEEKS 1-3) ? Please read the ins ...

Q1: BIOL1181 2250 Assignment 1: Applied Theory (WEEKS 1-3) ? Please read the instructions that have been posted on CANVAS before completing this assessment. Please use either Calibri (Font Size 11) or Arial Font (Size 10) to type your answers. Adhere to the space provided for each question. Question 1. You have recently joined a biotech company that specialises in the cloning and expression of human hormones for therapeutic use [Total = 12 marks]. Your first task it to express the Human Growth Hormone, whose structure is depicted below: Genomic DNA 5 5' size (bp) cDNA GH protein BIOL1181 Assignment 1: Applied Theory (WEEKS 1-3) Total Marks = 35 nukleotides 5175 5234 I exons Answer: ? IVS 1 Answer: 10 261 5'NT 5495 | ? 161 5655 5865 5984 6077 | ? ? IVS 2 ? IVS 3 209 120 93 31 40 55 IV 6241 165 • 65 IVS 4 253 6495 1 ? -3-23 1-31 32-71 72-126 127-191 (aa) V 195 6689 (21) You need to provide your supervisor with a strategy to clone this gene in an expression vector for expression in a bacterial cell system. You need to: 3'NT Poly A a. Explain to your supervisor which starting material you will use (genomic DNA? mRNA?) to prepare your insert, and why? [2 marks]. b. List the elements that must be present in this vector for the successful expression of the bacterial system, and why these elements are required? [4 marks]. BIOL1181 2250 Assignment 1: Applied Theory (WEEKS 1-3) c. List the mains experimental steps required for cloning your insert of interest into the vector, starting from extraction of the relevant nucleic acid from cells (as you have defined under Question 1a) and finishing with a pure population of bacteria that has acquired the plasmid. Indicate which enzyme(s) is(are) are required at each step [6 marks]? You can use a schematic. Answer:See Answer

READ MORE >>

Q1: 2. Given the below DNA sequence and the given Forward primer sequence (highl ...

Q1: 2. Given the below DNA sequence and the given Forward primer sequence (highlighted in yellow), design the reverse primer sequence (of a 20bp length) that you would have to purchase if you want to generate a 876bp amplicon. GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTG CTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCC AGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTG ATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGG GGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCA CACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTG CCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGG GGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGAC TGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGA CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGT GTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGA CAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGG TCCTGGGGATAGGGGSee Answer

READ MORE >>

Q1: 2 discuss what the graphs show and function as a representation for, and how ...

Q1: 2 discuss what the graphs show and function as a representation for, and how their data relate to allometry in vertebratesSee Answer

READ MORE >>

Q1: In the Tree Building Challenge exercise, please use the following steps to b ...

Q1: In the Tree Building Challenge exercise, please use the following steps to build a tree. Identify which tree of the options below is the one that you constructed. 1. Start on Peak 1. Reset the simulation until you get to this starting point. 2. Let some time pass. 3. Move a flower from Peak 1 to Peak 3 4. Let some time pass. 5. Move a flower from Peak 3 to Peak 4 6. Let some time pass. 7. Move a flower from Peak 1 to Peak 2. 8. Let some time pass.See Answer

READ MORE >>

Q1: project 1 is example of how it's need to be done. I have attach the map need ...

Q1: project 1 is example of how it's need to be done. I have attach the map needed for the assignment. In Image of the City, Kevin Lynch says that "Urban spaces should be legible. Legibility means the extent to which the cityscape can be ‘read', understood and experienced. People who move through the city engage in wayfinding. They need to be able to recognize and organize urban elements into a coherent pattern. These mental maps consist of five elements - paths edges nodes districts landmarks Many city dwellers cannot define what makes a city a great place to live, but most people can definitely state what makes a bad environment. Kevin Lynch suggests that a lack of attention to any one of these 5 areas results in infrastructure breakdown and therefore urban planners should target these areas in their neighborhood improvement efforts. ASSIGNMENT: Project 1 Part 1: Analyze the University of Maryland Campus and Areas along Route 1 - Select a University of Maryland Campus Plan, which is one of the subareas in the city of College Park. Print out the map on an 8.5" x 11" sheet and indicate the 5 urban elements - paths, edges, districts, nodes, landmarks. List 3 positives and negatives of the current urban plan. Use Google Earth (https://www.google.com/earth/) or maps from the College Park homepage (www.collegeparkmd.gov) as a base. Part 2: Select an Intervention -Based on your personal knowledge and experience of the campus, identify 1 improvement you would make as an urban designer to the campus plan. Part 3: Neighborhood and Area Identification - Locate the spot on a map and include the image in your submission. Part 4: Research and Analysis - explain the necessary change (intervention), describe the effect the change will have on the surrounding area and explain why this intervention will improve the UMD urban plan. Part 5: Visual and Graphic Support - Provide images, sketches and/or documentation from your research of what the change might look like. Your project will be 6 pages long: 1 UMD master plan (8.5" x 11") 3 typed written pages (8.5" x 11") 2 pages of photos, diagrams, images (8.5" x 11")/n Shifa Shaikh Professor Curtis RDEV 250 13 September 2023 Shaikh 1 Project 1 Kevin Lynch's, Image of the City, was a paramount publication in regards to urban planning, with his theory distributing the built environment into several urban elements-paths, nodes, landmarks, districts, and edges. The University of Maryland's campus can similarly be analyzed through the lens of Lynch's theory, delving into both its advantages and disadvantages. The current urban plan of UMD's sprawling 1,340 acre campus maintains a wide array of benefits. One ongoing utility of merit is the construction of the Purple Line, which will supply a system of increased connectivity and integration between the campus and surrounding communities. Moreover, over the past five years, campus development has progressed at a comprehensive scale, with the rapid construction and renovation of academic, research, housing, dining, and athletic facilities on campus to address any insufficiencies, including the A. James Clark Hall, Brendan Iribe Center, Heritage Community, and the E.A. Fernandez IDEA Factory. Lastly, the extensive variety of student residential communities-from residence halls on-campus to apartment complexes fringing the outskirts of UMD-allows for the accommodation of a diverse population on campus, fully furnished with an assortment of amenities, including health, wellness, and dining resources. On the underside of these assets, however, the campus plan has its share of shortcomings as well, outlined within the University of Maryland Campus Facilities Plan, which divides these drawbacks into varying categories. For instance, in terms of infrastructure, a few congregations Shaikh 2 of undersized and outdated buildings on campus may not fulfill today's preeminent research and learning expectations due to physical and functional deficiencies. In order to better satisfy the university's educational standards, these select buildings may be prospective sites for future renovation or redevelopment. For instance, in an article published by The Diamondback, in order to construct the state-of-the-art, ecologically progressive Edward St. John Learning and Teaching Center, UMD demolished Shriver Laboratory and a segment of Holzapfel Hall, two of the campus' more antiquated buildings. In terms of flaws in the campus' sprawling land assets, several districts are lacking in accessible open spaces, including rec fields, malls, quads, and courtyards. Moreover, other land assets are inadequately utilized, such as the area west of McKeldin Library which could be repurposed for infill development–the process of developing vacant, overlooked land in urban areas or other enhancements. Lastly, the lack of mobility is a limitation on campus. This issue is rooted in UMD's expansion following the expeditious increases in enrollment after World War II. Adhering to a suburban model of development that prioritized vehicles and roads, the campus effectively diminished its focus on pedestrian environments and open green spaces. The resulting repercussions seen today include the congestion of vehicles and an insufficient system of connectivity for pedestrian and bike networks across campus. In order to address this deficiency in maneuverability, one intervention I would integrate into the campus plan as an urban designer would be to add a pedestrian and bike bridge extending out of the Regents Drive parking garage and crossing overhead the street. The construction of a bridge overhead Regents Drive, a high-volume arterial street, would present a significant opportunity to enhance the campus' circulation system and establish an approach to mobility centralized around pedestrians. This pathway would serve as a means of safe access to Shaikh 3 the buildings and sidewalks of Regents Drive for those on bikes and scooters, further facilitating an ease of travel. Pedestrian and bike bridges are further instrumental in separating pedestrians and cyclists from vehicular traffic and adding an artistic element to the built environment. A bridge would additionally address the limited range of sight for both pedestrians and vehicles when navigating the street, with large shuttles parked adjacent to sidewalks that obstruct one's vision and can foster endangering situations for pedestrians and commuters alike. Thus, in order to progress with a sustainable pattern of development, UMD must adhere to Lynch's emphasis on the legibility of landscapes. Whether it be emphasizing pedestrian mobility and lessening the congestion of vehicular traffic to refurbishing campus infrastructure, UMD can reinforce this ideology by thoroughly contemplating each decision regarding the campus' growth and advancing towards a common, coordinated vision for the future. Figure 1) Hand-drawn sketch of proposed pedestrian bridge extending from the Regents Drive parking garage to the opposite side of the street. A M 2022.60pgle 8??? Shaikh 4 NO PARKING Figure 2) Hand-drawn sketch of pedestrian bridge concept from the opposite angle. Taw es 416 SECU Stadium Tyser Tower Upper Deck Cole Student Activities Building Benjamin P. Mitchell Art-Sociology Gossett Hall Johnson-Whittle A re Arundel 392 Dorchester R2 R20 R3 Union Lane Garage HH een Anne's Varsity Sports Teamhouse St. Mary's D Yahentamitsi|| Dining Somerset McKeldin Library D Stamp Student Union Health Center Bob "Turtle" Smith Stadium At Shipley Field Jimenez Chincoteague Figure 3) University of Maryland Campus Plan O J.Logan & Louise Schutz Football Practice Complex Jull HP Bioscience Research BBPatuxent Microbiology Biology-Psychology Campue DA H.J. Patterson Atlantic Francis Scott Key McKeldin Mall W1 Physical Sciences Complex ESJ Regents Drive Garage Hornbake Library Plant Sciences Woods Shaikh 5 — Industrial Ln J.M. Patterson Chemistry Sumone Toll Physics TT =districts ?=nodes (=intervention paths = landmarks - edges/n392 H R3 ten Varsity Sports Teamhouse R2 R20 nion Lane Garage Fieldhouse Dr St. Mary's Stamp Student Union Bob "Turtle Smith Stadum At Shipley Field Health Center McKeldin Library Jimenez Stadium Dr. Jull Logan & Louise Schutz Football Practice Complex BBPatuxent HP Bioscience Research ove Microbiology Bidogy-Psychology Campus Dr H.J. Patterson Sciences Complex McKelain Mall Regents Drive Garage Plant Sciences Hornbake Library Industrial Ln J.M. Patterson Symons Chemistry Toll Physics KK Chemical & Nuclear Engineering Kirwan C. Mitchell Miller Administration Engineering Reckord Armory 1... E.A. Fernandez IDEA Factory 405 Engineering Lab Martin Campus Dr Engineering Recreation Field Imagery Wind Tunnel X UMD Facilities Management | University of Maryland, DCGIS, M-NCPPC, MNCPPC, VITA, Esri, HERE, Garmin, INC... Turner Computer S Instructic Center Iribe CenteSee Answer

READ MORE >>

Q1: INSTRUCTIONS Need to create a Case Study, and follow instructions strictly Y ...

Q1: INSTRUCTIONS Need to create a Case Study, and follow instructions strictly You can choose any project, But it would be better you chose project Student location : any city, or state in United States/nSee Answer

READ MORE >>

Q1: 2. Find 2 favorite images that the artist created. Provide the title and yea ...

Q1: 2. Find 2 favorite images that the artist created. Provide the title and year the artwork was created.See Answer

READ MORE >>

Q1: Problem 4 (20 points). There are a wide number of student groups on campus, ...

Q1: Problem 4 (20 points). There are a wide number of student groups on campus, and many that are specific to the CEAE department. Identify a student group that you are interested in joining. (a) write a ½ page description of the organization, or group of which the local chapter represents. (b) then attend one of their meetings in the next two weeks, and write a brief summary (2-3 sentences) of what occurred during the meeting (feel free to include a screenshot of the meeting to document your attendance). Student groups include: AEI, AGC, ASHRAE, ASCE, EIA, EERI, EWB, and IES (the full list). If you are unable to attend a meeting before the due date of this assignment, then include one sentence about when the next meeting will take place, and when you will attend.See Answer

READ MORE >>

Q1: ??????? ALASALA FINAL PROJECT: BUDGETING College of Engineering Prepared b 1 ...

Q1: ??????? ALASALA FINAL PROJECT: BUDGETING College of Engineering Prepared b 1 2 3 B 5 2 0.91 10,52 2.04 3.55 0.98 0.78 3.06 1.29 1.05 3.82- 0.61-1.50 -0.49 Reception Living Room Bed Room (? -1.62 -3.82 10.62 B -3.00 -3.39 Bath Room C -1-1.50 -1.58 -3.00 10.62 -3.06 3.11 Entrance Kitchen Bed Room ARCHITECTURAL PLAN D 1.50-0.6 -3.06 2.16 0.91 1.50 9.92 3.55 10 3.06 1 2 3 B 4 5 Procedure 1- Knowing that the height of the floor is 3 meters, calculate the following: a. Number of blooks required to make this floor b. Doors c. Windows 2- List all the materials in one table named bill of material (BOM) and the quantities and the specifications. 3- Give a rough per unit quotation of each material. 4- Give a rough quotation of the labor cost for building this floor Report components This is a report not a presentation Introduction In the introduction explain what budgeting is and describe the floor you are doing budgeting to. Methodology Explain how you got the quantities and the specification of the materials Results List all the quantities and the pricesSee Answer

READ MORE >>
QUICK ORDER

Place a Quick Order

Our verified writers got you covered. Let us help you balance between studies, work, and family.

We provide our assistance to the numerous clients looking for a professional writing service.

Order Now
Designed and developed by Brian Mubichi (mubix)
WhatsApp